answer the question 351

a. Transcribe and translate the following template sequence of DNA starting with the first Methionine codon.

DNA Template Sequence

ATATATACAACACAATGTCATCCCCTACT

b. What would be the effect on the protein if the ninth nucleotide is changed from an A to a T?

c. Give the protein sequence for this change.

d. What is this mutation called?