Write a brief outline of the mechanisms in which DNA is used to generate protein.

/in /by

 Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells

 Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease. 

Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.

  • aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
  • aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

In modern terminology, diversity is understood to be a result of genetic variation. Which of the following is a recognized source of variation for

/in /by

In modern terminology, diversity is understood to be a result of genetic variation. Which of the following is a recognized source of variation for evolution?A. rampant changes to the dictionary of the genetic code B. recombination by crossing over in meiosis C. mistakes in protein folding D. binary fission E. mistakes in translation of structural genes

ower to MGF 1106. Click here to unfollow.

/in /by
  • ower to MGF 1106. Click here to unfollow.

Your firm’s strategic plan calls for a net increase in total assets of $100 million during the next five years, which represents an annual compounded growth rate of 15 percent. Equity growth is also projected to be 15 percent per year. Assume that the firm’s Total Asset Turnover will average 1.0 in each of the five years and Equity Financing percentages will remain constant at 50 percent. The firm projects Reported Income Index values to be 0.85 each year. What is the required Total Margin that will make this plan financially feasible?

Estimate the number of gallons of gasoline consumed by the total of all automobile drivers in the United States, per year.

/in /by

Estimate the number of gallons of gasoline consumed by the total of all automobile drivers in the United States, per year. Assume there are about 300,000,000 people in the United States, half of them have cars, they each drive 11,000 miles per year, and their cars get 22 miles per gallon of gas.

A hot air balloon has just lifted off and is rising at the constant rate of 2.4 m/s. Suddenly, one of the passengers realizes she has left her camera…

/in /by

A hot air balloon has just lifted off and is rising at the constant rate of 2.4 m/s. Suddenly, one of the passengers realizes she has left her camera on the ground. A friend picks it up and tosses it straight upward with an initial speed of 12.0 m/s. If the passenger is 2.5 m above her friend when the camera is tossed, how high is she when the camera reaches her? m

A hot air balloon has just lifted off and is rising at the constant rate of 2.4 m/s. Suddenly, one ofthe passengers realizes she has left her camera on the ground. A friend picks it up and tosses…

reaction e – nation redox or non-redox 3cm) + 6NaOH(Q) :5NaCI(gg) + NaC|03(,g) + 3H20(l) 002(9) + H20″) – H2C03(Q) 2 Nt-hhgg) + Ca(OH)2(Q) 2 NHa(gg)…

/in /by

which of these reactions, if any, display disproportionation? please explain

reaction e – nation redox or non-redox 3cm) + 6NaOH(§Q) —:5NaCI(gg) + NaC|03(§,g) + 3H20(l) 002(9) + H20“) —- H2C03(§Q) 2 Nt-héhgg) + Ca(OH)2(§Q) —»2 NHa(gg) + 2H20(I) + CaCl2(ag) madam) + mum) 92mm) +3 l2(s) + 4’Hzou) redo >L 4. Describe disproportlonatlon. Next. conslder the reactlons shown in Question 3and indicate if any of the reactions demonstrate disproportionation. Answer (2 Marks)VfiqmoorHopc-‘HDA is 0L Cmdfion ”rx which mSou“: €QQCWLS t3 bah ox‘tdrzflc“ wot rch’iQd.

Question 1 Describe transition state theory and how it applies to enzyme catalysis. Why is a transition-state analog not necessarily the same as a

/in /by

Question 1

Describe transition state theory and how it applies to enzyme catalysis. Why is a transition-state analog not necessarily the same as a competitive inhibitor?

Question 2

Why does pH affect the activity of an enzyme? The enzymatic activity of lysozyme is optimal at pH 5.2 and decreases above and below this pH value. Lysozyme contains two amino acid residues in the active site essential for catalysis: Glu35 and Asp52. The pK value for the carboxyl side chains of these two residues are 5.9 and 4.5, respectively. What is the ionization state of each residue at the pH optimum of lysozyme? How can the ionization states of these two amino acid residues explain the pH-activity profile of lysozyme?

in this unbalanced chemical reaction, which element is oxidized and which is the reduced?

/in /by

in this unbalanced chemical reaction, which element is oxidized and which is the reduced?  Cl2 + NaBr —> NaCl + Br2

chlorine is reduced, sodium is oxidized

chlorine is oxidized, bromine is reduced

bromine is oxidized, chlorine is reduced

sodium is reduced, chlorine is oxidized

In determining the volume of the irregularly shaped object, any air bubbles sticking to the surface of the object when it is submerged cause…

/in /by

In determining the volume of the irregularly shaped object, any air bubbles sticking to the surface of the object when it is submerged cause systematic errors. Will this error give an experimental density that is too high or too low?

65 kg block of ice is sliding by you on a very slippery floor at 3.5 m/s. As it goes by, you give it a kick perpendicular to its path. Your foot is…

/in /by

0.65 kg block of ice is sliding by you on a very slippery floor at 3.5 m/s. As it goes by, you give it a kick perpendicular to its path. Your foot is in contact with the ice block for 0.0035 seconds. The block eventually slides at an angle of 22 degrees from its original direction (labelled in the diagram). The overhead view shown in the diagram is approximately to scale. The arrow represents the average force your toe applies briefly to the block of ice.